Orniginating from Aegilops tauscii accession CPI110672. CPI110672/Langdon synthetic wheat shows intermediate response to Pst pathotypes 198 E16 A+ J+ T+ 17+ (“198”) and 239 E237 A- 17+ 33+
Key Information
Crop
Wheat
Disease resistance(s)
Wheat stripe rust
Resistance type
All stage resistance
Source
Triticum aestivum
First reported
Athiyannan N, Zhang P, McIntosh R, Chakraborty S, Hewitt T, Bhatt D, Forrest K, Upadhyaya N, Steuernagel B, Arora S, Huerta J, Hayden M, Wulff BBH, Ayliffe M, Hickey LT, Lagudah E, Periyannan S. Haplotype variants of the stripe rust resistance gene Yr28 in Aegilops tauschii. Theor Appl Genet. 2022 Dec;135(12):4327-4336. doi: 10.1007/s00122-022-04221-w
Additivity
YrAT672 is a haplotype of Yr28 and YrAS2388
Chromosomal location
4DS
Markers
SNP-KASP
| Marker Type | Marker Name | Allele 1 Primer (resistant) | Allele 2 Primer (susceptible) | Common Primer | Published location |
|---|---|---|---|---|---|
| SNP-KASP | KASPYr28 | TATGCTAGAAGATATTGGG | TATGCTAGAAGATATTGGC | TGACATTTGAGATACTGACCAC | Hu, Y., Huang, X., Wang, F. et al. Development and validation of gene-specific KASP markers for YrAS2388R conferring stripe rust resistance in wheat. Euphytica 217, 206 (2021). https://doi.org/10.1007/s10681-021-02937-2 |