Yr15

Highly effective resistance gene worldwide although sporadic virulence has been detected but not since 2003. Not used in Australian varieties but backcrossed dertivatives are avaialble

Key Information

Crop

Wheat

Disease resistance(s)

Wheat stripe rust

Resistance type

All stage resistance

Source

T. turgidum var. dicoccoides

First reported

Gerechter-Amitai, Z.K., van Silfhout, C.H., Grama, A. et al. Yr15 — a new gene for resistance to Puccinia striiformis in Triticum dicoccoides sel. G-25. Euphytica 43, 187–190 (1989). https://doi.org/10.1007/BF00037912

Chromosomal location

1BS

Genomic Sequence

Genbank accession number MG649384

Germplasm availability

Aroona*3/Yr15; Avocet S*6/Yr15; Spear*3/Yr15

Additional Information

Kin1 and Kin2 primers are intellectual property of Carmel, the economic corporation of Haifa University, so if you plan to use them for commercial applications, read information : Please note that the information presented (including all rights thereto) is intellectual property owned by Carmel – The economic corporation of Haifa University and/or its third party licensors which is, inter alia, protected under patent applications. If you wish to make any use of such information you are required t

Markers

SNP-KASP

Marker Type	Marker Name	Allele 1 Primer (resistant)	Allele 2 Primer (susceptible)	Common Primer	Published location
SNP-KASP	Kin1	GACCCTTTGTTTTGTCAGAGC	GACCCTTTGTTTTGTCAGAGT	AAACATTGAGTAAGACTAGTAGCC	Klymiuk, V., Yaniv, E., Huang, L. et al. Cloning of the wheat Yr15 resistance gene sheds light on the plant tandem kinase-pseudokinase family. Nat Commun 9, 3735 (2018). https://doi.org/10.1038/s41467-018-06138-9
SNP-KASP	Kin2	CTGCTACTGGACAGTGTAACG	CTGCTACTGGACAGTGCAACA	CCCATGTCACGAGGCT	Klymiuk, V., Yaniv, E., Huang, L. et al. Cloning of the wheat Yr15 resistance gene sheds light on the plant tandem kinase-pseudokinase family. Nat Commun 9, 3735 (2018). https://doi.org/10.1038/s41467-018-06138-9