Highly effective resistance gene worldwide although sporadic virulence has been detected but not since 2003. Not used in Australian varieties but backcrossed dertivatives are avaialble
Key Information
Crop
Wheat
Disease resistance(s)
Wheat stripe rust
Resistance type
All stage resistance
Source
T. turgidum var. dicoccoides
First reported
Gerechter-Amitai, Z.K., van Silfhout, C.H., Grama, A. et al. Yr15 — a new gene for resistance to Puccinia striiformis in Triticum dicoccoides sel. G-25. Euphytica 43, 187–190 (1989). https://doi.org/10.1007/BF00037912
Chromosomal location
1BS
Genomic Sequence
Genbank accession number MG649384
Germplasm availability
Aroona*3/Yr15; Avocet S*6/Yr15; Spear*3/Yr15
Additional Information
Kin1 and Kin2 primers are intellectual property of Carmel, the economic corporation of Haifa University, so if you plan to use them for commercial applications, read information : Please note that the information presented (including all rights thereto) is intellectual property owned by Carmel – The economic corporation of Haifa University and/or its third party licensors which is, inter alia, protected under patent applications. If you wish to make any use of such information you are required t
Markers
SNP-KASP
Marker Type | Marker Name | Allele 1 Primer (resistant) | Allele 2 Primer (susceptible) | Common Primer | Published location |
---|---|---|---|---|---|
SNP-KASP | Kin1 | GACCCTTTGTTTTGTCAGAGC | GACCCTTTGTTTTGTCAGAGT | AAACATTGAGTAAGACTAGTAGCC | Klymiuk, V., Yaniv, E., Huang, L. et al. Cloning of the wheat Yr15 resistance gene sheds light on the plant tandem kinase-pseudokinase family. Nat Commun 9, 3735 (2018). https://doi.org/10.1038/s41467-018-06138-9 |
SNP-KASP | Kin2 | CTGCTACTGGACAGTGTAACG | CTGCTACTGGACAGTGCAACA | CCCATGTCACGAGGCT | Klymiuk, V., Yaniv, E., Huang, L. et al. Cloning of the wheat Yr15 resistance gene sheds light on the plant tandem kinase-pseudokinase family. Nat Commun 9, 3735 (2018). https://doi.org/10.1038/s41467-018-06138-9 |
History
RM
Rohit Mago
5 November, 2024
- Updated genomic sequence - genbank accession number mg649384
RM
Rohit Mago
5 November, 2024
- Updated genomic sequence - genbank accession number: mg649384