Yr47 and Lr52 are two distinct genes which map close to each other. Lr52 is resistant to a large number of lefa rust pathotypes. Yr47 is resistant to134 E16A+Yr17+Yr27+, virulence gainst Pst 198, Pst 239 is not known
Key Information
Crop
Wheat
Disease resistance(s)
Wheat stripe rust
Resistance type
All stage resistance
Source
Triticum aestivum Aus28183
First reported
Hiebert C, Thomas J, McCallum B (2005) Locating the broadspectrum wheat leaf rust resistance gene Lr52 (LrW) to chromosome 5B by a new cytogenetic method. Theor Appl Genet 110:1453–1457
Chromosomal location
5BS
Germplasm availability
Aus28183/Ventura Backcrossed lines
Markers
SSR
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|---|---|---|---|
| SSR | sun180 | ctttcgtctgtttgtcatttt | atccaaatccaaaaacaactc | 55 | 200/195 | Qureshi N, Bariana H, Forrest K, Hayden M, Keller B, Wicker T, Faris J, Salina E, Bansal U. Fine mapping of the chromosome 5B region carrying closely linked rust resistance genes Yr47 and Lr52 in wheat. Theor Appl Genet. 2017 Mar;130(3):495-504. doi: 10.1 |