Provides Adult plant pleotropic resistance to wheat stem rust, stripe rust and powdery mildew.
Key Information
Crop
Wheat
Disease resistance(s)
Multi-pathogen resistance
Resistance type
Adult plant resistance
Source
Triticum aestivum
First reported
Herrera-Foessel SA, Lagudah ES, Huerta-Espino J, Hayden MJ, Bariana HS, Singh D, Singh RP. New slow-rusting leaf rust and stripe rust resistance genes Lr67 and Yr46 in wheat are pleiotropic or closely linked. Theor Appl Genet. 2011 Jan;122(1):239-49. doi: 10.1007/s00122-010-1439-x
Linked Phenotypes
same as Lr67/Sr55/Pm46/LTN3
Additivity
Not known
Genomic Sequence
Genbank accession number MK425206.1
Known/other genes in the region
same as Lr67/Sr55/Pm46/LTN3
Markers
SNP-KASP
| Marker Type | Marker Name | Allele 1 Primer (resistant) | Allele 2 Primer (susceptible) | Common Primer | Published location |
|---|---|---|---|---|---|
| SNP-KASP | TM4_67 | TCATCATCGGCAGGATCCTGCTTC | TCATCATCGGCAGGATCCTGCTTG | AACGTACGTAATCTTGCTTACTGA | Moore, J., Herrera-Foessel, S., Lan, C. et al. A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat Genet 47, 1494–1498 (2015). https://doi.org/10.1038/ng.3439 |