Provides Adult plant pleotropic resistance to wheat leaf rust, stripe rust, stem rust and powdery mildew.
Key Information
Crop
Wheat
Disease resistance(s)
Multi-pathogen resistance
Resistance type
Adult plant resistance
Source
Triticum aestivum
First reported
Singh RP, Mujeeb-Kazi A, Huerta-Espino J. Lr46: a gene conferring slow-rusting resistance to leaf rust in wheat. Phytopathology. 1998 Sep;88(9):890-4. doi: 10.1094/PHYTO.1998.88.9.890. PMID: 18944865.
Linked Phenotypes
Leaf tip necrosis
Chromosomal location
1BL
Known/other genes in the region
Also known as Yr29/Sr58/Pm39/Ltn2
Additional Information
One of the most widely distributed APR globally. Lr46 is present in a large number of bread and durum wheats
Information for SNP-CAPS marker available from Dr Evans Lagudah under GRDC MTA
Markers
SSR
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|---|---|---|---|
| SSR | wmc44 | GGTCTTCTGGGCTTTGATCCT | GTTGCTAGGGACCCGTAGTGG | 61 | 242bp | Suenaga K, Singh RP, Huerta-Espino J, William HM. Microsatellite markers for genes lr34/yr18 and other quantitative trait Loci for leaf rust and stripe rust resistance in bread wheat. Phytopathology. 2003 Jul;93(7):881-90. doi: 10.1094/PHYTO.2003.93.7.881 |
SNP-CAPS
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Restriction enzyme | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|
| SNP-CAPS | csLV46G22 |