Yr35 and Lr53 are two distinct closely linked genes
Key Information
Crop
Wheat
Disease resistance(s)
Wheat stripe rust
Resistance type
All stage resistance
Source
T. turgidum var. dicoccoides
First reported
Marais, G.F., Pretorius, Z.A., Wellings, C.R. et al. Leaf rust and stripe rust resistance genes transferred to common wheat from Triticum dicoccoides. Euphytica 143, 115–123 (2005). https://doi.org/10.1007/s10681-005-2911-6
Chromosomal location
6BS
Markers
SSR
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|---|---|---|---|
| SSR | cfd1 | ACCAAAGAACTTGCCTGGTG | AAGCCTGACCTAGCCCAAAT | 60 | 220/275 | Dadkhodaie, N.A., Karaoglou, H., Wellings, C.R. et al. Mapping genes Lr53 and Yr35 on the short arm of chromosome 6B of common wheat with microsatellite markers and studies of their association with Lr36. Theor Appl Genet 122, 479–487 (2011). https://doi. |