Provides Adult plant pleotropic resistance to wheat leaf rust, stripe rust, stem rust and powdery mildew.
Key Information
Crop
Wheat
Disease resistance(s)
Multi-pathogen resistance
Resistance type
Adult plant resistance
Source
Triticum aestivum
First reported
William M, Singh RP, Huerta-Espino J, Islas SO, Hoisington D (2003) Molecular marker mapping of leaf rust resistance gene Lr46 and its association with stripe rust resistance gene yr29 in wheat. Phytopathology. 2003 Feb;93(2):153-9. doi: 10.1094/PHYTO.2003.93.2.153. PMID: 18943129.
Linked Phenotypes
Same as Lr46/Sr58/Pm39/LTN2
Chromosomal location
1BL
Known/other genes in the region
Same as Lr46/Sr58/Pm39/LTN2
Additional Information
One of the most widely distributed APR globally. Lr46 is present in a large number of bread and durum wheats
Markers
SSR
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|---|---|---|---|
| SSR | wmc44 | GGTCTTCTGGGCTTTGATCCT | GTTGCTAGGGACCCGTAGTGG | 61 | 242 | Suenaga K, Singh RP, Huerta-Espino J, William HM. Microsatellite markers for genes lr34/yr18 and other quantitative trait Loci for leaf rust and stripe rust resistance in bread wheat. Phytopathology. 2003 Jul;93(7):881-90. doi: 10.1094/PHYTO.2003.93.7.881 |