Effective against all pgt isolates in Australia but has not been used in breeding. Introgressed as a 2S translocation which also carries Sr32 (on 2DS). Recombinants which have separated SrAest1t from Sr32 have been produced.
Key Information
Crop
Wheat
Disease resistance(s)
Wheat stem rust
Resistance type
All stage resistance
Source
Aegilops speltoides
First reported
Mago, R., Verlin, D., Zhang, P. et al. Development of wheat–Aegilops speltoides recombinants and simple PCR-based markers for Sr32 and a new stem rust resistance gene on the 2S#1 chromosome. Theor Appl Genet 126, 2943–2955 (2013). https://doi.org/10.1007/s00122-013-2184-8
Chromosomal location
2D-2S#1
Known/other genes in the region
Sr32
Germplasm availability
C82.2 -70 typeI,recombinant that have separated Sr32 from SrAes1t
Markers
PCR
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|---|---|---|---|
| PCR | csSrAes1t | TTCCACGATGCCAGATTTACA | GGTTGTGTGAAGCCACATGAA | 58 | 120bp | Mago, R., Verlin, D., Zhang, P. et al. Development of wheat–Aegilops speltoides recombinants and simple PCR-based markers for Sr32 and a new stem rust resistance gene on the 2S#1 chromosome. Theor Appl Genet 126, 2943–2955 (2013). https://doi.org/10.1007/ |