N/A
Key Information
Crop
Wheat
Disease resistance(s)
Wheat stem rust
Resistance type
All stage resistance
Source
Triticum monococcum/ Triticum boeoticum
First reported
Kerber ER, Dyck PL. Inheritance of stem rust resistance transferred from diploid wheat (Triticum monococcum) to tetraploid and hexaploid wheat and chromosome location of the gene involved. Canadian Journal of Genetics and Cytology, 1973, 15:397–409.
Chromosomal location
7AL
Genomic Sequence
LN883743.1
Germplasm availability
Present in several Australian wheat varieties e.g., W3534 and Schomburgk. Also available as NIL and backcross lines, described in- Paull JG, Pallotta MA, Langridge P, The TT. RFLP markers associated
Additional Information
An second allele of Sr22 (Sr22b) has been identified and descrided in. Luo J, Rouse MN, Hua L, Li H, Li B, Li T, Zhang W, Gao C, Wang Y, Dubcovsky J, Chen S (2022) Identification and characterization of Sr22b, a new allele of the wheat stem rust resistance gene Sr22 effective against the Ug99 race group. Plant Biotechnol J 20:554–563
S22GM is a gene specific dominant marker. Additional Sr22 markers are available from https://maswheat.ucdavis.edu/protocols/Sr22
Markers
PCR
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|---|---|---|---|
| PCR | S22GM | CAGCTAAGATACTTGGATATCTCTTC | CCTGGAAGCTTACAACCAGA | 176bp | Steuernagel B, Periyannan SK, Hernández-Pinzón I, Witek K, Rouse MN, Yu G, Hatta A, Ayliffe M, Bariana H, Jones JD, Lagudah ES, Wulff BB. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture. Nat Biotechnol. 2016 Jun; |