Sr50 is effective against all stem rust races in Australia and is also effectve against Ug99. However, virulence has been found in Kazakhstan recently. Originally introgressed into wheat from rye but was assocaited with stcky dough character. However, recombinants with shortened rye segment without sticky dough caharacter as 1DL/1RS are now available
Key Information
Crop
Wheat
Disease resistance(s)
Wheat stem rust
Resistance type
All stage resistance
Source
Secale cereale
Chromosomal location
1BL-1RS, 1DL-1RS
Genomic Sequence
Genbank accession number KT725812.1
Germplasm availability
Shepherd, K.W. 1973. Homoeology of wheat and alien chromosomes controlling endosperm protein phenotypes. In Proceedings of the 4th International Wheat Genetics Symposium, Columbia, Mo., 6–11 August 19
Additional Information
Previously known as SrR
Markers
PCR
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|---|---|---|---|
| PCR | IB-267 | GCAAGTAAGCAGCTTGATTTAGC | AATGGATGTCCCGGTGAGTGG | 60 | ~230bp | Mago, .R., Spielmeyer, .W., Lawrence, .G. et al. Identification and mapping of molecular markers linked to rust resistance genes located on chromosome 1RS of rye using wheat-rye translocation lines. Theor Appl Genet 104, 1317–1324 (2002). https://doi.org/ |
| PCR | Sr50-5p | TTCAGTGAAGTTGCCGCTGT | GCATGCTCTCAAGCTCCTTCT | 60 | 467bp | Mago, R., Zhang, P., Vautrin, S. et al. The wheat Sr50 gene reveals rich diversity at a cereal disease resistance locus. Nature Plants 1, 15186 (2015). https://doi.org/10.1038/nplants.2015.186 |
History
m
mago_rohit@hotmail.com
8 November, 2024
- Updated genomic sequence - genbank accession number kt725812.1