Sr33 is effective against all stem rust races in Australia and is also effectve against Ug99 but not has been used in wheat varities
Key Information
Crop
Wheat
Disease resistance(s)
Wheat stem rust
Resistance type
All stage resistance
Source
Aegilops tauschii
First reported
Kerber ER and Dyck PL (1979) Resistance to stem rust and leaf rust of wheat in Aegilops squarrosa and transfer of a gene for stem rust resistance to hexaploid wheat. Proceedings of the 5th International Wheat Genetics Symposium 358-364.
Additivity
Sr2
Chromosomal location
1DL
Genomic Sequence
Genbank accession number KF031291
Known/other genes in the region
Lr21
Germplasm availability
Available as backcrossed lines in various backgrounds
Markers
PCR
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|---|---|---|---|
| PCR | AtM5 F1 R1 | CTTGCCAACTCAGTTCCACC | TTGCATTATCATTCCGTGCAC | Periyannan S, Moore J, Ayliffe M, Bansal U, Wang X, Huang L, Deal K, Luo M, Kong X, Bariana H, Mago R, McIntosh R, Dodds P, Dvorak J, Lagudah E. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99. Science. 2013 | ||
| PCR | AtM5 F2 R2 | CATATCGTACAATACATGCACC | TATTCTGAAGGGACAAGCGG | Periyannan S, Moore J, Ayliffe M, Bansal U, Wang X, Huang L, Deal K, Luo M, Kong X, Bariana H, Mago R, McIntosh R, Dodds P, Dvorak J, Lagudah E. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99. Science. 2013 | ||
| PCR | AtM5 F3 R3 | ATGCTCCAGCCAATATATTCG | AGCACATCACACAACCTCTCGG | Periyannan S, Moore J, Ayliffe M, Bansal U, Wang X, Huang L, Deal K, Luo M, Kong X, Bariana H, Mago R, McIntosh R, Dodds P, Dvorak J, Lagudah E. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99. Science. 2013 |
SSR
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|---|---|---|---|
| SSR | BARC152 | CTTCCTAAAATCGGGCAACCGCTTGTT | CTTCCTAAAATCGGGCAACCGCTTGTT | 50 | 141bp | Sambasivam PK, Bansal UK, Hayden MJ, Lagudah, E, and Bariana HS. Identification of markers linked with stem rust resistance genes Sr33 and Sr45. 11th International Wheat Genetics Symposium 2008 Proceedings.Edited by Rudi Appels Russell Eastwood Evans Lagu |
History
m
mago_rohit@hotmail.com
5 November, 2024
- Updated genomic sequence - genbank accession number kf031291