Sr24

Sr24 is effective against all stem rust races in Australia. However, virulence exists overseas

Key Information

Crop

Wheat

Disease resistance(s)

Wheat stem rust

Resistance type

All stage resistance

Source

Agropyron elongatum

First reported

McIntosh RA , Dyck PL, Green GJ. Inheritance of leaf rust and stem rust resistances in wheat cultivars Agent and Agatha. Aust. J. Agric. Res., 1976, 28, 37-45

Linked Phenotypes

Lr24

Chromosomal location

3DL/3Ae

Germplasm availability

Widespread in Australian wheat cultivars e.g., LRPB Lancer, RGT Cesario, Sunmaster and also several back crossed liines are available

Additional Information

Also avaialble as a1BL/1BS-3Ae translocation (Amigo type)

Markers

SSR

Marker Type	Marker Name	Forward Primer	Reverse Primer	Annealing temperature (°C)	Size (bp): Resistant allele/Susceptible allele	Published location
SSR	Barc71	GCGCTTGTTCCTCACCTGCTCATA	GCGTATATTCTCTCGTCTTCTTGTTGGTT		103bp, 85bp/ 107bp	Mago, R., Bariana, H.S., Dundas, I.S. et al. Development of PCR markers for the selection of wheat stem rust resistance genes Sr24 and Sr26 in diverse wheat germplasm. Theor Appl Genet 111, 496–504 (2005). https://doi.org/10.1007/s00122-005-2039-z

PCR

Marker Type	Marker Name	Forward Primer	Reverse Primer	Annealing temperature (°C)	Size (bp): Resistant allele/Susceptible allele	Published location
PCR	Sr24#12	CACCCGTGACATGCTCGTA	AACAGGAAATGAGCAACGATGT	62	500bp	Mago, R., Bariana, H.S., Dundas, I.S. et al. Development of PCR markers for the selection of wheat stem rust resistance genes Sr24 and Sr26 in diverse wheat germplasm. Theor Appl Genet 111, 496–504 (2005). https://doi.org/10.1007/s00122-005-2039-z
PCR	Sr24#50	CCCAGCATCGGTGAAAGAA	ATGCGGAGCCTTCACATTTT	57	200bp	Mago, R., Bariana, H.S., Dundas, I.S. et al. Development of PCR markers for the selection of wheat stem rust resistance genes Sr24 and Sr26 in diverse wheat germplasm. Theor Appl Genet 111, 496–504 (2005). https://doi.org/10.1007/s00122-005-2039-z