New source of leaf rust resistance in durum wheats
Key Information
Crop
Wheat
Disease resistance(s)
Wheat leaf rust
Resistance type
All stage resistance
Source
Triticum turgidum var. durum
First reported
Qureshi N, Bariana H, Kolmer JA, Miah H, Bansal U. Genetic and Molecular Characterization of Leaf Rust Resistance in Two Durum Wheat Landraces. Phytopathology. 2017 Nov;107(11):1381-1387. doi: 10.1094/PHYTO-01-17-0005-R
Chromosomal location
6BS
Additional Information
Maybe same as Lr61
Markers
SSR
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|---|---|---|---|
| SSR | sun684 | cgttcgttttctatcgtttta | ggttatccatgtgattcaaga | 124/128 | Qureshi N, Bariana H, Kolmer JA, Miah H, Bansal U. Genetic and Molecular Characterization of Leaf Rust Resistance in Two Durum Wheat Landraces. Phytopathology. 2017 Nov;107(11):1381-1387. doi: 10.1094/PHYTO-01-17-0005-R | |
| SSR | sun683 | gacgttcaaaaagttgaaaag | aacctctagacacaaatgcaa | 160/null | Qureshi N, Bariana H, Kolmer JA, Miah H, Bansal U. Genetic and Molecular Characterization of Leaf Rust Resistance in Two Durum Wheat Landraces. Phytopathology. 2017 Nov;107(11):1381-1387. doi: 10.1094/PHYTO-01-17-0005-R |