Lr23 is widely used in Australian durum and bread wheats. Virulence is present but the gene can still provide effective resistance in combination with other genes
Key Information
Crop
Wheat
Disease resistance(s)
Wheat leaf rust
Resistance type
All stage resistance
Source
Triticum turgidum var. durum
First reported
Watson IA, Luig NH (1961) Leaf rust on wheat in Australia: a systematic scheme for the classification of strains. In Proc Linn Soc, NSW 86:241–250
Chromosomal location
2BS
Known/other genes in the region
Several Australian wheats carry Lr23
Markers
SSR
| Marker Type | Marker Name | Forward Primer | Reverse Primer | Annealing temperature (°C) | Size (bp): Resistant allele/Susceptible allele | Published location |
|---|---|---|---|---|---|---|
| SSR | sun471 | gaaaagcgacaatggatttat | cagcagctacacttggtttac | 200bp/ 184-196bp(susceptible) | Chhetri, M., Bariana, H., Wong, D. et al. Development of robust molecular markers for marker-assisted selection of leaf rust resistance gene Lr23 in common and durum wheat breeding programs. Mol Breeding 37, 21 (2017). https://doi.org/10.1007/s11032-017-0 |
SNP-KASP
| Marker Type | Marker Name | Allele 1 Primer (resistant) | Allele 2 Primer (susceptible) | Common Primer | Published location |
|---|---|---|---|---|---|
| SNP-KASP | sunKASP_47 | gaactccaggcaagcgaaT | gaactccaggcaagcgaaC | tcatatataaactgatcgcacgtaa | Chhetri, M., Bariana, H., Wong, D. et al. Development of robust molecular markers for marker-assisted selection of leaf rust resistance gene Lr23 in common and durum wheat breeding programs. Mol Breeding 37, 21 (2017). https://doi.org/10.1007/s11032-017-0 |
| SNP-KASP | sunKASP_48 | ccgagctagaacaatgaaaacA | ccgagctagaacaatgaaaacC | ggtgacggtccggtgtaata | Chhetri, M., Bariana, H., Wong, D. et al. Development of robust molecular markers for marker-assisted selection of leaf rust resistance gene Lr23 in common and durum wheat breeding programs. Mol Breeding 37, 21 (2017). https://doi.org/10.1007/s11032-017-0 |
History
m
mago_rohit@hotmail.com
29 October, 2024
- Updated description - lr23 is widely used in australian durum and bread wheats. virulence is present but the gene can still provide effective resistance in combination with other genes