New source of APR leaf rust resistance has not been used in Australia
Key Information
Crop
Wheat
Disease resistance(s)
Wheat leaf rust
Resistance type
Adult plant resistance
Source
Triticum aestvum cultivar Sanata Fe
First reported
Kolmer JA, Su Z, Bernardo A, Bai G, Chao S. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat. Theor Appl Genet. 2018 Jul;131(7):1553-1560. doi: 10.1007/s00122-018-3097-3
Chromosomal location
3BL
Markers
SNP-KASP
| Marker Type | Marker Name | Allele 1 Primer (resistant) | Allele 2 Primer (susceptible) | Common Primer | Published location |
|---|---|---|---|---|---|
| SNP-KASP | IWB10344 | gtagcaacatatggtGaAtcatcaT | gtagcaacatatggtGaAtcatcaG | catacaggtagcagatacgcaa | Kolmer JA, Su Z, Bernardo A, Bai G, Chao S. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat. Theor Appl Genet. 2018 Jul;131(7):1553-1560. doi: 10.1007/s00122-018-3097-3 |